- Home
- GenHunter DNA Sequencing Service
GenHunter DNA Sequencing Service
GenHunter is a leading service provider of Sanger DNA sequencing for many universities & biotech companies in the Nashville area due to our high-quality sequences, fast turnaround time, friendly customer service, & free pickups (available at Vanderbilt locations). Ask about our special offers to try us for free today!
*Our facility has remained operational during the COVID-19 pandemic, taking precautions to ensure the safety of our clients and employees. If your lab prefers not to have visitors, you may leave the tubes in a plastic bag (or drop box) near your door or you may drop them off at our site.
How to Order
Read our sequencing information sheet for submission guidelines, then click on the order form here & email it to sequencing@genhunter.com
- Deadlines: Submit the order form by 10am CST M-F to qualify for next-day results (usually ready the next morning, guaranteed 1-3 business days max).*If you need a pickup but are running behind on time, send us an email by 10am letting us know you will have samples ready and then email the completed form by 11am.
- Pickups
- Vanderbilt pickups are from 10:30am-noon M-F
- Samples that are ready by 10:30am may qualify for next-day results (if they are not ready, they may be picked up the next business day)
- At your lab, create a designated pickup location with a GenHunter-labeled box or rack in a -20C, 4C, or cold room for our courier to find, placing tubes in the same order as they occur on the form. We can also provide you a box.
- Drop-offs/Deliveries
- Drop off or deliver your samples to our location at 624 Grassmere Park Ste 17, Nashville TN 37211 between 9am-5pm Mon-Fri - if the door is locked, you may drop the tubes in a plastic bag or envelope through the mail slot.
- Send an electronic copy of your order form via email - if we receive the order form by 10am and samples by noon, you may qualify for next-day results (next business day) as the schedule allows (guaranteed 1-3 days max).
Submission Guidelines
Click on this printer-friendly sequencing information sheet for submission guidelines & more
- Tubes: samples & primers should be in separate tubes (if they are pre-mixed, please let us know in the email when you order)
- 1.5 mL flip-top tubes - default method
- 8-strip PCR tubes - may be used for exact multiples of 8 (no partial strips or empty tubes), corresponding with adjacent lines on the form (*please normalize the concentrations for this option)
- Volume: 8 µL per reaction (10 µL if sample concentration is low)
- Samples
- Purification: use a high-quality commercial purification kit (such as Qiagen)
- Be sure to elute in autoclaved dH2O (not the kit buffer) - salt-containing buffers will inhibit reactions and cause poor reads
- For genomic DNA (gDNA) ONLY: please isolate and amplify the specific target sequence prior to purification (*bacterial gDNA is the exception as it does not need to be isolated and amplified by PCR)
- Concentration: can be above or below the recommended ranges below (but please dilute if more than 50% above the upper limit)
- PCR Products: 20-40 ng/µL
- Plasmids: 100-300 ng/µL
- BACs & gDNA: 500-1000 ng/µL (for notes on gDNA prep, please see "Purification" above)
- Primers
- Requirements:
- primers should be an exact match with the template (a mismatch can result in a failed reaction)
- length of ~17-25 bp
- annealing site more than 30 bp away from the target
- Tm (melting temperature) of 50-65C
- no dimerization, significant hairpin formation, or secondary binding sites
- low to moderate specific binding at 3' end
- GC content of ~40-60% (high GC can cause mispriming)
- only one primer can be used per reaction or else it will have a mixed sequence (this is an important difference between sequencing and regular PCR reactions)
- Custom Primers (you only need to provide your own primer if we do not have it in stock): provide at a 2µM concentration
- To convert ng/µL to µM: µM = [(ng/µL)/(Molecular Weight)] x 1000 {Molecular Weight ≈ (# bases in primer) x 32}
- Stock Primers (we supply the following primers so you don't have to! If you would like us to add another common primer to this list, please let us know by emailing sequencing@genhunter.com):
- T7 TAATACGACTCACTATAGGG
T7-Rev CTAGTTATTGCTCAGCGGTG- T3 ATTAACCCTCACTAAAGGGA
- CMV-For CGCAAATGGGCGGTAGGCGTG
- BGH-Rev TAGAAGGCACAGTCGAGG
- SP6 ATTTAGGTGACACTATA
- M13F GTAAAACGACGGCCAG *Our default M13F is M13F(-20)
- M13R CAGGAAACAGCTATGAC
- M13F(-40) GTTTTCCCAGTCACGAC
Saving Tubes
Tubes are saved for 2 weeks from the date they are run.
- During this time frame, you may request your saved tubes to be used for new reactions (such as using a previously submitted sample to be run with a new primer) - simply submit an order form and any tubes that are not already in our possession, and refer to the date they were last used so we may find them easily and confirm whether enough volume is leftover.
- Time-saver: primers that are frequently used by your lab may be requested to be saved for a longer period so you do not have to resubmit them each time. Label the lid of the tube with the primer name, then label the side with the lab name, date, and your initials.
Results
Results are usually ready the next morning (if it is a business day), and guaranteed within 1-3 business days max. Sometimes same-day results can be arranged if the schedule allows.
- Sequencing text files & chromatograms (.seq & .ab1 files) are emailed upon completion - view a sample sequence here.
- Chromatograms (.ab1 files) can be viewed on free programs such as SnapGene Viewer which you can download here.
Troubleshooting
Below are some recommendations to help prevent some common issues such as noisy data, failed reactions, & short reads - if you have any questions before or after sequencing, please let us know & we will be happy to help!
- Run samples on an agarose gel to check the concentration & quality of DNA
- Prep samples with high-quality kits such as Qiagen - use fresh reagents & elute with nuclease-free H2O instead of buffer
- Check samples for the presence of multiple priming sites or templates, which can cause mixed/overlapping reads
- Confirm that the primer is an exact match with the template
- Use primers that have not been degraded from too many freeze-thaw cycles or long-term storage at 4C
Advantages
- High Quality
- Long reads up to 1050 bp on our ABI 3130xl, with good resolution over 700-800 bp
- Polite & knowledgeable tech support & customer service
- Fast Turnaround
- Results are almost always ready the next morning (see details under "Results")
- Convenient
- Fast response time
- Complimentary pickups are available for all Vanderbilt labs (drop-offs are accepted from all locations, and other Nashville pickups may be added for a small fee)
- Located near I-65 in Nashville, we are in driving distance of many area universities & biotech companies
- Trusted Source
- Our loyal customer base has been using our service since 2003 due to our high level of care and quality of results
- Free Repeats
- Repeats are run as soon as space is available - one free repeat per reaction, as needed
Pricing
- Standard Sanger Sequencing (MOST POPULAR OPTION - ask about our current promos for a discount, or to try us for free!)
- 1-15 reactions: $8.15 / rxn
- 16+ reactions: $8 / rxn
- Bulk Sequencing (96-Well Plate)
- Use this order form for plates
- $7 / rxn ($672 / plate)
- Run Only (you do the reactions & we run it)
- 1-15 reactions: $6 / run
- 16+ reactions: $4 / run
Holiday Hours
We will be closed on the following holidays (*please note that if a holiday falls on a Saturday then we will be closed the Friday before it, and if it falls on a Sunday we will be closed the Monday after it):
- New Years Day
- Memorial Day
- Independence Day
- Labor Day
- Thanksgiving Day
- Black Friday
- Christmas Eve
- Christmas Day
Since 2003, GenHunter has been working with researchers at many local institutions including Vanderbilt University, Tennessee State University (TSU), Middle Tennessee State University (MTSU), Meharry Medical College, and Lipscomb University--we are proud to provide quality data to help facilitate the important research of our biomedical community!
Questions or comments? Please email us at sequencing@genhunter.com or use the form below: