GenHunter DNA Sequencing Service

GenHunter is a leading service provider of Sanger DNA sequencing for many universities & biotech companies in the Nashville area due to our high-quality sequences, fast turnaround time, friendly customer service, & free pickups (available at Vanderbilt locations). Ask about our special offers to try us for free today!

*Our facility has remained operational during the COVID-19 pandemic, taking precautions to ensure the safety of our clients and employees. If your lab prefers not to have visitors, you may leave the tubes in a plastic bag (or drop box) near your door or you may drop them off at our site.

How to Order

Read our sequencing information sheet for submission guidelines, then click on the order form here & email it to sequencing@genhunter.com

• Deadlines: Submit the order form by 10am CST M-F to qualify for next-day results (usually ready the next morning, guaranteed 1-3 business days max).*If you need a pickup but are running behind on time, send us an email by 10am letting us know you will have samples ready and then email the completed form by 11am.

• Pickups
• Vanderbilt pickups are from 10:30am-noon M-F
• Samples that are ready by 10:30am may qualify for next-day results (if they are not ready, they may be picked up the next business day)
• At your lab, create a designated pickup location with a GenHunter-labeled box or rack in a -20C, 4C, or cold room for our courier to find, placing tubes in the same order as they occur on the form. We can also provide you a box.

• Drop-offs/Deliveries
• Drop off or deliver your samples to our location at 624 Grassmere Park Ste 17, Nashville TN 37211 between 9am-5pm Mon-Fri - if the door is locked, you may drop the tubes in a plastic bag or envelope through the mail slot.
• Send an electronic copy of your order form via email - if we receive the order form by 10am and samples by noon, you may qualify for next-day results (next business day) as the schedule allows (guaranteed 1-3 days max).

Submission Guidelines

Click on this printer-friendly sequencing information sheet for submission guidelines & more

• Tubes: samples & primers should be in separate tubes (if they are pre-mixed, please let us know in the email when you order)
• 1.5 mL flip-top tubes - default method
• 8-strip PCR tubes - may be used for exact multiples of 8 (no partial strips or empty tubes), corresponding with adjacent lines on the form (*please normalize the concentrations for this option)

• Volume: 8 µL per reaction (10 µL if sample concentration is low)

• Samples

• Purification: use a high-quality commercial purification kit (such as Qiagen)
• Be sure to elute in autoclaved dH2O (not the kit buffer) - salt-containing buffers will inhibit reactions and cause poor reads
• For genomic DNA (gDNA) ONLY: please isolate and amplify the specific target sequence prior to purification (*bacterial gDNA is the exception as it does not need to be isolated and amplified by PCR)
• Concentration: can be above or below the recommended ranges below (but please dilute if more than 50% above the upper limit)
• PCR Products: 20-40 ng/µL
• Plasmids:        100-300 ng/µL
• BACs & gDNA: 500-1000 ng/µL (for notes on gDNA prep, please see "Purification" above)

• Primers

• Requirements:
• primers should be an exact match with the template (a mismatch can result in a failed reaction)
• length of ~17-25 bp
• annealing site more than 30 bp away from the target
• Tm (melting temperature) of 50-65C
• no dimerization, significant hairpin formation, or secondary binding sites
• low to moderate specific binding at 3' end
• GC content of ~40-60% (high GC can cause mispriming)
• only one primer can be used per reaction or else it will have a mixed sequence (this is an important difference between sequencing and regular PCR reactions)

• Custom Primers (you only need to provide your own primer if we do not have it in stock): provide at a 2µM concentration
• To convert ng/µL to µM: µM = [(ng/µL)/(Molecular Weight)] x 1000   {Molecular Weight ≈ (# bases in primer) x 32}
• Stock Primers (we supply the following primers so you don't have to! If you would like us to add another common primer to this list, please let us know by emailing sequencing@genhunter.com):
• T7                  TAATACGACTCACTATAGGG
• T7-Rev          CTAGTTATTGCTCAGCGGTG    
• T3                  ATTAACCCTCACTAAAGGGA           
  
• CMV-For        CGCAAATGGGCGGTAGGCGTG  
• BGH-Rev      TAGAAGGCACAGTCGAGG   
• SP6                ATTTAGGTGACACTATA
• M13F            GTAAAACGACGGCCAG  *Our default M13F is M13F(-20)
  
• M13R            CAGGAAACAGCTATGAC
• M13F(-40)    GTTTTCCCAGTCACGAC    

The captcha you entered is incorrect. Please try again.